Skip to main content

Table 1 The oligonucleotides used in this study

From: Downregulation of microRNA-182-5p contributes to renal cell carcinoma proliferation via activating the AKT/FOXO3a signaling pathway

Namea Sequence(5′->3′)b
miR-182-5p mimics (sense) UUUGGCAAUGGUAGAACUCACACU
NC (sense) ACTACTGAGTGACAGTAGA
miR-182-5p F TTTGGCAATGGTAGAACTCACACT
U6 F TGCGGGTGCTCGCTTCGGCAGC
FLOT1 F CCCATCTCAGTCACTGGCATT
FLOT1 R CCGCCAACATCTCCTTGTTC
CCND1 F GCTGCGAAGTGGAAACCATC
CCND1 R CCTCCTTCTGCACACATTTGAA
CDK4 F ATGGCTACCTCTCGATATGAGC
CDK4 R CATTGGGGACTCTCACACTCT
GAPDH F AAGGTGAAGGTCGGAGTCA
GAPDH R GGAAGATGGTGATGGGATTT
FLOT1-utr F TCGAGAGCTC GCTGAAGTTGCCTGAATGAT
FLOT1-utr R TCGAGTCGAC AGCCCATCCCTCAGTCTT
  1. aF, forward primer; R, reverse primer.
  2. bRestriction sites are in bold.