Skip to main content

Table 5 Primers and probes used for real-time PCR analysis for 5 target genes

From: Sensitivity and reproducibility of standardized-competitive RT-PCR for transcript quantification and its comparison with real time RT-PCR

Gene Forward Primer Reverse Primer Probe
ACTB TGAGCGCGGCTACAGCTT CCTTAATGTCACACACGATT 6FAM5'-ACCACCACGGCCGAGCGG-3'TAMRA
PCNA CTGCAGAGCATGGACTCGTC GTAGGTGTCGAAGCCCTCAGA 6FAM5'-ACGTCTCTTTGGTGCAGCTCACCCTG-3'TAMRA
CDKN2A CATAGATGCCGCGGAAGGT CCGGAGGTTTCTCAGAGCCT 6FAM5'-CCTCAGACATCCCCGATTGAAAGAACC-3'TAMRA
E2F1 GAACTGAGGCCTGGGTGATTT CCACCCATGGCTGTCAGTC 6FAM5'-TCTGTCTCCCTCCCTCACTTTCCCAATAA-3'TAMRA
RB1 TTCCAGAAAATAAATCAGATGGTATGTAA CAGTGGTTTAGGAGGGTTGCTT 6FAM5'-CAGCACTTCTTTTGAGCACACGGTCG-3'TAMRA
Primers used for StaRT PCR analysis for 5 target genes
Gene Forward primer Reverse Primer for NT Reverse Primer for CT
ACTB GATTCCTATGTGGGCGACGAG CCATCTCTTGCTCGAAGTCC CCATCTCTTGCTCGAAGTCCCCATCTCTTGCTCGAAGTCCGCCAGCCAGGTCCAGACGCA
CDKN2A GGAGCCCAACTGCGCCGACC CCTTCGGTGACTGATGATCTAA CCTTCGGTGACTGATGATCTAAGGAGCCCAACTGCGCCGACCCCCGTGGACCTGGCTGAG
E2F1 TGATACCCCAACTCCCTCTA AAAGCAGGAGGGAACAGAGC AAAGCAGGAGGGAACAGAGCAAAGCAGGAGGGAACAGAGCACTGCAGGGACCACAGG
PCNA GCTCCAGCGGTGTAAACCTGCA CGTGCAAATTCACCAGAAGGCA CGTGCAAATTCACCAGAAGGCACGTGCAAATTCACCAGAAGGCATCAACTTCATTTCATAGTCTGA
RB1 TTTCAGAAGGTCTGCCAACACCAA GTGTCCACCAAGGTCCTGAGATCC GTGTCCACCAAGGTCCTGAGATCCGTGTCCACCAAGGTCCTGAGATCCCATTTCTGCCAGTTTCTGCTGAAA