Skip to main content

Table 1 NID1 and NID2 oligonucleotides for MSP and RT-PCR analyses

From: Nidogen 1 and 2 gene promoters are aberrantly methylated in human gastrointestinal cancer

Gene Method Primer 1 Oligonucleotide sequencea Primer 2 Oligonucleotide sequence Product size T (°C) annealing
NID-1 MSP methyl NID1_MF GAGGGTTTCGTTTCGTTTAGC NID1_MR AACGCCGTTCGCTAAAAATCG 144 58°C
NID-2 MSP methyl NID2_MF TAGTATTGGTAACGACGATAGTATC NID2_MR AAATTCGAAACTAACGCGACACG 141 58°C
NID-1 MSP unmethyl NID1_UF GAGGGTTTTGTTTTGTTTAGT NID1_UR AAAAACACCATTCACTAAAAATCA 147 51°C
NID-2 MSP unmethyl NID2_UF TAGTATTGGTAATGATGATAGTATT NID2_UR AAATTCAAAACTAACACAACACA 141 51°C
NID-1 RT-PCR NID1_181F AGGAGCTCTTTCCCTTCGGC NID1_354R CGGGGGTTCACTCGTAGCAA 174 60°C
NID-2 RT-PCR NID2_722F TAGGCGCTTACGAGGAGGTCAA NID2_813R TATCAGACCCATCAGATGCCAAAAC 92 63°C
  1. a All primers for MSP were designed on predicted bisulfite-modified DNA sequences (see Additional files 3 and 4)