Skip to main content

Table 3 Primers for real time RT-PCR analysis

From: Androgen-regulated genes differentially modulated by the androgen receptor coactivator L-dopa decarboxylase in human prostate cancer cells

Gene Forward primer Reverse primer
TMEPAI TGCCGTTCCATCCTGGTT AGACAGTGACAAGGCTAGAGAAAGC
YME1L1 GAGCTTGGACACAACCGATAACT CCGCAGTGTACAGGGATTGA
SYTL2 TCTGCCTTGAGAAAACAAACAGTT GCCAGTGGGTGGCACTAAAA
UNC5C GGCCGTCCAGGTGAATCA TGCATTCTTGCCTGTGAAGTG
TGM2 TCTCTGGGCCTTTGTTTCCTT GATCCTTGGAGATGAGCTGGTT
PTGDR TCAGGACTCCAAGGTGCAAAG TCTGGCTGGAGGTCTTGAGATC
DRD3 GAATTCCCTGAGTCCCACCAT CCATTGCTGAGTTTTCGAACTTC
GAPDH GAAGGTGAAGGTCGGAGT GAAGATGGTGATGGGATTTC