Skip to main content

Table 2 Primers and probes (FAM/TAMRA labeled) for Real time Q-PCR assays.

From: Fra-1 governs cell migration via modulation of CD44 expression in human mesotheliomas

Oligo Name Primers and Probes
FRA1-F CTGTGCTTGAACCTGAGGCA
FRA1-R GGTGAAAGGAGTTAGGGAGGGT
FRA1-P TGCACACCCCCACACTCATGACC
HPRT-F AAGCTTGCTGGTGAAAAGG
HPRT-R AAACATGATTCAAATCCCTGA
HPRT-P TGTTGGATTTGAAATTCCAGACAAGTTTGTT