Skip to main content

Advertisement

Table 1 Sequences of primers used for QPCR

From: The proprotein convertase PC5/6 is protective against intestinal tumorigenesis: in vivo mouse model

Assessed mRNA Forward Primer Reverse Primer
human PC5AB ACTCTTCAGAGGGTGGCTA GCTGGAACAGTTCTTGAATC
mouse PC5AB TGACCACTCTTCAGAGAATGGATAC GAGATACCCACTAGGGCAGC
mouse PC5A AGGATTCAAGAACTGTTCCA AGCATACAGAAGCCTCCTT
mouse PC5B GCAATGCCTCCCACTCCC TGCTCGTAAAACTCAGCCTCC
mouse Furin CATGACTACTCTGCTGATGG GAACGAGAGTGAACTTGGTC
Cre ATGATCCGAATAACTACCTG ACAATATTTACATTGGTCCAG
human S14 GGCAGACCGAGATGAATCCTCA CAGGTCCAGGGGTCTTGGTCC
mouse S16 GCTACCAGGGCCTTTGAGATG AGGAGCGATTTGCTGGTGTGG