Skip to main content

Table 1 Sequences of qMSP and qRT-PCR primers used in this study

From: Methylation-mediated silencing and tumour suppressive function of hsa-miR-124 in cervical cancer

Gene Primers(5'-3') Size (bp) Annealing (°C)
hsa-miR-124-1 F: CGGCGGGGAGGATGTT   58.9
  R: ATAAAAAACGACGCGTATACGTACG 94 59.4
  P: CGGCGTTTTTTATTTTT-Xsprobe   70.0
hsa-miR-124-2 F: GGGTAATTAATTTGGATTTACGTCGTTAT   59.9
  R: CGTAAAAATATAAACGATACGTATACCTACGT 138 58.8
  P: TTTACAACACACGCCTAAA -Xsprobe   69.0
hsa-miR-124-3 F: ACGCGGCGAAGACGTTT   59.0
  R: CGAACGACGAACGTCGAAA 95 59.4
  P: AAAATCCTCGCCCGAAAAACGCGA   70.4
IGFBP7 F: CCCAGGTGTACTTGAGCTGTGA 89 58.9
  R: TGAACTCCATAGTGACCCCTTTTT   58.9
snRNP U1A F: TCCTCACCAACCTGCCAGA 71 58.8
  R: TGAAGCCAGGGAACTGATTGA   59.3
  1. F: forward; R: reverse; P: probe; Xsprobe: minor groove binder probe