Skip to main content

Table 1 Sequences of the oligonucleotides used in this study.

From: Cell cycle-dependent regulation of the bi-directional overlapping promoter of human BRCA2/ZAR2 genes in breast cancer cells

Oligo Name Sequence (5'-3') Purpose Product size
P1 TCAGCGAGAAGAGAACAC BRCA2/ZAR2 gene promoter amplification 497 bp
P2 TTGGCAGAGACAAAAGGGC   
P3 CGACTGGAGCACGAGGACACTGA Gene racer ZAR2 5'-RACE 814 bp
P4 GCTGTTTGTGCCCTGAGAGTCC   
P5 AAGCTTATGGAGCGCTTTGTCCGT PCR of C-terminal FLAG-tagged ZAR2 975 bp
P6 GGATCCCATCACATATTTAAAGCTGTAAA   
P7 AAGCTTATGGAGCGCTTTGTCCGT PCR of N-terminal FLAG-tagged ZAR2 978 bp
P8 TCTAGATCACATCACATATTTAAAGCTGTAAAT   
P9 CACTGTAAAGATTGTAAGACCAGG ZAR2 RT-PCR 140 bp
P10 CTGACATTGGATTGCTTCTACTCG   
P11 GTACAGGAAACAAGCTTCTGA BRCA2 RT-PCR 271 bp
P12 GACTAACAGGTGGAGGTAAAG   
P13 GCTCGTCGTCGACAACGGCTC Beta-actin RT-PCR 352 bp
P14 CAAACATGATCTGGGTCATCTTCTC   
P15 ACCCUUACAAGAGGGCGCAGCUUAA siRNA#1  
P16 UUAAGCUGCGCCCUCUUGUAAGGGU   
P17 UCCUGUGGCAAUAUUUACAGCUUUA siRNA#2  
P18 UAAA GCUGUAAAUAUUGCCACAGGA   
P19 ACCACAUGAGAGCGGCGACUUCUAA Control siRNA#1  
P20 UUAGAAGUCGCCGCUCUCAUGUGGU   
P21 UCCCGGUAUAAAUUUCGACUGUUUA Control siRNA#2  
P22 UAAACAGUCGAAAUUUAUACCGGGA   
P23 ATCACTACTTGTCATCGTCATCCTTGTAGTCG FLAG reverse primer