Skip to main content

Advertisement

Table 1 Primers sequences used in the real-time Q-PCR. Note: the abbreviations used in the table: FW indicates forward; REV, reverse.

From: Differential chemosensitization of P-glycoprotein overexpressing K562/Adr cells by withaferin A and Siamois polyphenols

IL6 FW GACAGCCACTCACCTCTTCA
IL6 REV AGTGCCTCTTTGCTGCTTTC
IL8 FW GCTCTCTTGGCAGCCTTCCTGA
IL8 REV ACAATAATTTCTGTGTTGGCGC
A/BFL-1 FW GATTTCATATTTTGTTGCGGAGTTC
A/BFL-1 REV TTTCTGGTCAACAGTATTGCTTCAG
MCP1 FW ACTCTCGCCTCCAGCATG
MCP1 REV TTGATTGCATCTGGCTGAGC
A20 FW CCTTGCTTTGAGTCAGGCTGT
A20 REV TAAGGAGAAGCACGAAACATCGA
CYCLIND1 FW CGCCCCACCCCTCCAG
CYCLIND1 REV CCGCCCAGACCCTCAGACT
VEGF FW GCCTCCCTCAGGGTTTCG
VEGF REV GCGGCAGCGTGGTTTC
MDR1 FW CTGCTTGATGGCAAAGAAATAAAG
MDR1 REV GGCTGTTGTCTCCATAGGCAAT