Skip to main content

Table 2 The sequence, respective amplicon size and Tm of the oligonucleotide primers used in Q-PCR

From: Invasion of ovarian cancer cells is induced byPITX2-mediated activation of TGF-β and Activin-A

Gene Name Forward primer (5′- 3′) Reverse primer (5′- 3′) Amplicon size (bp) Tm (°C)
18S rRNA GATTCCGTGGGTGGTGGTGC AAGAAGTTGGGGGACGCCGA 134 60
POLR2A TGGACCCACCGGCATGTTCT GCCCCTGGGGTCATTCCACT 141 60
CLDN4 GGCTGCTTTGCTGCAACT CAGAGCGGGCAGCAGAATAC 110 60
CLDN7 GTGGCAGATGAGCTCCTATGC CATCCACAGCCCCTTGTACA 80 60
DSM GCAGCAAAGGGCGGAGAT TGTTAATGTGCTGCTCCACTGA 80 60
VIM ACACCCTGCAATCTTTCAGACA GATTCCACTTTGCGTTCAAGGT 80 60
FN1 CCTTCATGGCAGCGGTTT AGCGTCCTAAAGACTCCATGATCT 94 60
PITX2 CGCGAAGAAATCGCTGTGT CGACGATTCTTGAACCAAACC 78 58
TGFB1 GTGACAGCAGGGATAACACACTG CATGAATGGTGGCCAGGTC 80 60
TGFB2 GCTGAGCGCTTTTCTGATCCT CGAGTGTGCTGCAGGTAGACA 80 60
TFGB3 CACCACAACCCTCATCTAATCCT CCTGGCCCGGGTTGTC 100 60
SNAI1 TCGGAAGCCTAACTACAGCGA AGATGAGCATTGGCAGCGAG 140 60
SNAI2 ATGAGGAATCTGGCTGCTGT CAGGAGAAAATGCCTTTGGA 119 60
CDH1 GTCACTGACACCAACGATAATCT TTTCAGTGTGGTGATTACGACGTA 100 60
MMP9 ACCTCGAACTTTGACAGCGAC GAGGAATGATCTAAGCCCAGC 113 60
INHBA GTGAGTGCCCGAGCCATATAG CATGCGGTAGTGGTTGATGACT 80 60
CDH2 CCATCAAGCCTGTGGGAATC GCAGATCGGACCGGATACTG 76 60
ZEB1 CAATGATCAGCCTCAATCTGCA CCATTGGTGGTTGATCCCA 117 60
ZEB2 AAGCCCCATCAACCCATACAAG AAATTCCTGAGGAAGGCCCA 124 60