Fig. 1

Five different methods detect the presence of 5-methycytosine in miRNA. a Picture illustrates miRNA migration in 5% agarose gel electrophoresis. Image acquisition was performed on ChemiDoc MP (Bio-Rad, France). b HPLC chromatograms of 5-methylcytosine (5mC) in miRNA. According to the calibration with standard dC and 5mdC, peaks with a retention time of 1.364 and 2.271 were attributed to dC and 5mdC, respectively. c Picture illustrates a Dot blot using 5mC antibody. miRNA were spotted on to a positive-charged nylon membrane and blotted with 5mC antibody (Active Motif, France). “S” sample of miRNA extracted to glioblastoma cells. In an arbitrary manner, we decided to use the synthetic methylated miRNA-4665-3p as control as this miRNA was composed of 6 CG (MIMAT0019740 # CUCGGCCGCGGCGCGUAGCCCCCGCC, according to the miRBase website.) Image acquisition was performed on ChemiDoc MP (Bio-Rad, France). d Graph illustrates the quantification of the miRNA sample using the ELISA method (Methylamp Global DNA Methylation Quantification kit, Epigentek-Euromedex, France). Data (averagestandard deviation) are representative of three independent experiments. e Schematic representation of miRNA bisulfite sequencing and miRNA Array analysis (Qiagen, France) of anti-5methylcytosine-mediated miRNA immunoprecipitation. F. Heatmap representation for adenosine methylated enrichment of miRNA in three gliobklastoma cell lines: T98G, U118 and LN229