Skip to main content

Table 1 Primer sequences used in PCR

From: RIPK3 activation induces TRIM28 derepression in cancer cells and enhances the anti-tumor microenvironment

Gene name Specis   Sequence
ACTIN human F GGACTTCGAGCAAGAGATGG
ACTIN human R AGCACTGTGTTGGCGTACAG
CXCL1 human F AGGGAATTCACCCCAAGAAC
CXCL1 human R TGGATTTGTCACTGTTCAGCA
IL-8 human F TCTGCAGCTCTGTGTGAAGG
IL-8 human R AATTTCTGTGTTGGCGCAGT
IL-1β human F AAGTACCTGAGCTCGCCAGTGA
IL-1β human R TGCTGTAGTGGTGGTCGGAGAT
CCL4 human F AAGCTCTGCGTGACTGTCCT
CCL4 human R GCTTGCTTCTTTTGGTTTGG
TNF-α human F CAGAGGGCCTGTACCTCATC
TNF-α human R GGAAGACCCCTCCCAGATAG
TRIM28 human F CTCGGGATGGTGAACGTACT
TRIM28 human R GCAATGTTGCATGTTTGTCC
Il-6 mouse F AGTTCCTCTCTGCAAGAGACT
Il-6 mouse R ATGTGTAATTAAGCCTCCGACTT
Ccl4 mouse F GCCCTCTCTCTCCTCTTGCT
Ccl4 mouse R GTCTGCCTCTTTTGGTCAGG
Cd80 mouse F CCATGTCCAAGGCTCATTCT
Cd80 mouse R TTCCCAGCAATGACAGACAG
Cd40 mouse F CCTGGCTTTGGAGTTATGGA
Cd40 mouse R CCGGGACTTTAAACCACAGA
Cd86 mouse F ATGCACCATGGGCTTGGCAA
Cd86 mouse R AACTTTTGCTGGTCCTGCCAAA
Actin mouse F CCACACCTTCTACAATGAGC
Actin mouse R TGAGGTAGTCAGTCAGGTC