Skip to main content

Correction: Identification of lymphocyte cell-specific protein-tyrosine kinase (LCK) as a driver for invasion and migration of oral cancer by tumor heterogeneity exploitation

The Original Article was published on 11 June 2021

Correction: Mol Cancer 20, 88 (2021)

https://doi.org/10.1186/s12943-021-01384-w

Following publication of the original article [1], the authors would like to correct the sequence information for two RT-qPCR primers (MMP1 forward; LCK forward) listed in Table 1.

Table 1 List of RT-qPCR primers used in this study

The primer sequences (5’ > 3’) currently read:

MMP1 forward: TGTGAGGCGGTAGTAGGACA

LCK forward: GACAGCATTCACCAGGACCA

The primer sequences (5’ > 3’) should read:

MMP1 forward: CACGCCAGATTTGCCAAGAG

LCK forward: GATGGGGTACTACAACGGGC

The correction does not have any effect on the results or conclusions of the article. The authors would like to apologize for these errors and any confusion that these might have caused.

Reference

  1. Weiße J, Rosemann J, Müller L, et al. Identification of lymphocyte cell-specific protein-tyrosine kinase (LCK) as a driver for invasion and migration of oral cancer by tumor heterogeneity exploitation. Mol Cancer. 2021;20:88. https://doi.org/10.1186/s12943-021-01384-w.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Author information

Authors and Affiliations

Authors

Corresponding author

Correspondence to Tony Gutschner.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Weiße, J., Rosemann, J., Müller, L. et al. Correction: Identification of lymphocyte cell-specific protein-tyrosine kinase (LCK) as a driver for invasion and migration of oral cancer by tumor heterogeneity exploitation. Mol Cancer 22, 50 (2023). https://doi.org/10.1186/s12943-023-01758-2

Download citation

  • Published:

  • DOI: https://doi.org/10.1186/s12943-023-01758-2