Skip to main content
Download PDF

Correction: Identification of lymphocyte cell-specific protein-tyrosine kinase (LCK) as a driver for invasion and migration of oral cancer by tumor heterogeneity exploitation

Molecular Cancer volume 22, Article number: 50 (2023) Cite this article

The Original Article was published on 11 June 2021

Correction: Mol Cancer 20, 88 (2021)

https://doi.org/10.1186/s12943-021-01384-w

Following publication of the original article [1], the authors would like to correct the sequence information for two RT-qPCR primers (MMP1 forward; LCK forward) listed in Table 1.

Table 1 List of RT-qPCR primers used in this study
Full size table

The primer sequences (5’ > 3’) currently read:

MMP1 forward: TGTGAGGCGGTAGTAGGACA

LCK forward: GACAGCATTCACCAGGACCA

The primer sequences (5’ > 3’) should read:

MMP1 forward: CACGCCAGATTTGCCAAGAG

LCK forward: GATGGGGTACTACAACGGGC

The correction does not have any effect on the results or conclusions of the article. The authors would like to apologize for these errors and any confusion that these might have caused.

Reference

  1. Weiße J, Rosemann J, Müller L, et al. Identification of lymphocyte cell-specific protein-tyrosine kinase (LCK) as a driver for invasion and migration of oral cancer by tumor heterogeneity exploitation. Mol Cancer. 2021;20:88. https://doi.org/10.1186/s12943-021-01384-w.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Author information

Author notes

  1. Julia Rosemann and Lisa Müller contributed equally to this work.

Authors and Affiliations

  1. Junior Research Group ‘RNA biology and pathogenesis’, Faculty of Medicine, Martin Luther University Halle-Wittenberg, 06120, Halle, Germany

    Jonas Weiße, Julia Rosemann & Tony Gutschner

  2. Institute of Molecular Medicine, Section for Pathobiochemistry, Faculty of Medicine, Martin Luther University Halle-Wittenberg, 06120, Halle, Germany

    Lisa Müller & Mechthild Hatzfeld

  3. Department of Oral and Maxillofacial Plastic Surgery, Faculty of Medicine, Martin Luther University Halle-Wittenberg, 06120, Halle, Germany

    Matthias Kappler

  4. Department of Cranio Maxillofacial Surgery, Paracelsus Medical University, 90471, Nuremberg, Germany

    Alexander W. Eckert

  5. Institute of Molecular Medicine, Section for Molecular Cell Biology, Faculty of Medicine, Martin Luther University Halle-Wittenberg, 06120, Halle, Germany

    Markus Glaß, Danny Misiak & Stefan Hüttelmaier

  6. Institute of Molecular Medicine, Section for Molecular Oncology, Faculty of Medicine, Martin Luther University Halle-Wittenberg, 06120, Halle, Germany

    Wolfgang G. Ballhausen

  7. Institute of Pathology, Section for Experimental Pathology, Medical Faculty, Martin Luther University Halle-Wittenberg, 06112, Halle, Germany

    Monika Haemmerle

Authors
  1. Jonas Weiße
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Julia Rosemann
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Lisa Müller
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Matthias Kappler
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Alexander W. Eckert
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Markus Glaß
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Danny Misiak
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Stefan Hüttelmaier
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Wolfgang G. Ballhausen
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Mechthild Hatzfeld
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. Monika Haemmerle
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. Tony Gutschner
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Tony Gutschner.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Weiße, J., Rosemann, J., Müller, L. et al. Correction: Identification of lymphocyte cell-specific protein-tyrosine kinase (LCK) as a driver for invasion and migration of oral cancer by tumor heterogeneity exploitation. Mol Cancer 22, 50 (2023). https://doi.org/10.1186/s12943-023-01758-2

Download citation

  • Published:

  • DOI: https://doi.org/10.1186/s12943-023-01758-2

Molecular Cancer

ISSN: 1476-4598