Inhibition of RPN2 expression led to the deregulation of CD63 glycosylation

To investigate whether CD63 was glycosylated by RPN2, MCF7-ADR and MDA-MB-231-luc-D3H2LN (MM231-LN) cells were transiently transfected with siRNA against RPN2, and the glycosylation state of CD63 was examined using western blotting. The reduction in RPN2 expression after transduction with the RPN2 siRNA was confirmed using western blotting (Figure 1A). The RPN2 siRNA had no effect on total CD63 expression in either breast cancer cell line (Figure 1B). However, as shown in Figure 1C, the molecular weight of CD63 decreased in RPN2 siRNA-treated cells compared to control siRNA-treated cells (N.C.) in the MM231-LN (upper panel) and MCF7-ADR (lower panel) cell lines. In addition, to confirm whether the molecular weight of CD63 actually decreased after deglycosylation, N-glycanase was added to cell lysates of MCF7-ADR and MM231-LN cells transfected with control or RPN2 siRNAs. As shown in Figure 1D, the molecular weight of glycosylated CD63 decreased after treatment with N-glycanase in both breast cancer cell lines, suggesting that the smeared band represents the glycosylated form of CD63. Furthermore, a non-glycosylated form of CD63 (25 kDa) and a less glycosylated form of CD63 (35 kDa) emerged from the 50 kDa glycosylated form of CD63 (Figure 1D) [7]. The N-glycanase experiment demonstrated the differences in the molecular weight of various forms of the CD63 protein. These results indicated that RPN2 contributes to the N-glycosylation of CD63 in human breast cancer cells.

CD63 localization was regulated by RPN2

It is well known that glycosylation affects the localization of proteins within the cytoplasm, membranes and pericellular matrix [10]. CD63 is a ubiquitously expressed protein that is localized within the endosomal system [5]. We performed an apoptosis assay using Hoechst staining and a caspase-3/7 assay in the MCF7-ADR and MM231-LN cells after RPN2 or CD63 siRNA transfection. As shown in Figure 2A and B, we found that neither RPN2 nor CD63 silencing induced apoptosis. In addition, knockdown of RPN2 or CD63 slightly inhibited cell proliferation in MCF7-ADR and MM231-LN cells (Figure 2C). To determine the localization of CD63, we performed immunofluorescence staining of CD63 in MCF7-ADR and MM231-LN cells after a control or RPN2 siRNA transfection. In MM231-LN and MCF7-ADR cells transfected with control siRNAs, CD63 was localized in the cell membrane, as indicated by PKH26 staining (Figure 2D: MM231-LN and 2E: MCF7-ADR; N.C.). Notably, CD63 aggregated at the nuclear periphery in RPN2-silenced cells more than in control siRNA treated cells (Figure 2D: MM231-LN and 2E: MCF7-ADR; RPN2 siRNA). These results indicate that the localization of CD63 was regulated by RPN2-mediated N-glycosylation.

The invasive ability and drug resistance of breast cancer cell lines were regulated by CD63

The relationship between CD63 and cancer cell malignancy has previously been reported; however, the exact contribution of CD63 to cancer malignancy is poorly understood. As shown in Figure 2, we found that knockdown of RPN2 led to abnormal localization of CD63, suggesting that disruption of RPN2 expression resulted in the suppression of CD63 function. We previously showed that RPN2 contributes to invasiveness [11] and drug resistance in cancer cells [9]. These observations prompted us to determine whether CD63 contributed to cancer invasiveness or drug resistance. The reduction of CD63 expression after transfection with the CD63 siRNA was confirmed using qRT-PCR and western blotting in MM231-LN cells (Figure 3A and B). The CD63 siRNA had no effect on cell viability 24 hours after transfection in MM231-LN cells (Figure 3C). To examine whether CD63 could influence the invasive ability of breast cancer cells, MM231-LN cells were used in in vitro transwell invasion assays after CD63 siRNA treatment. As shown in Figure 3D, the invasion of MM231-LN cells was suppressed by CD63 siRNA treatment compared with the control siRNA treatment. Similarly, inhibition of RPN2 expression by siRNA significantly affected the invasiveness of MM231-LN cells (Figure 3D).

Next, the reduction of CD63 expression after transfection with the CD63 siRNA was confirmed using qRT-PCR and western blotting in MCF7-ADR cells (Figure 3E and F). To examine the contribution of CD63 to drug resistance, we measured the half-maximal inhibitory concentration (IC50) of docetaxel in MCF7-ADR cells. We found that CD63 silencing in MCF7-ADR cells (P < 0.05, IC50 = 28.28 ± 1.30 nM) decreased drug resistance against docetaxcel compared to control (IC50 = 35.94 ± 4.42 nM) and RPN2 knockdown cells (P < 0.01, IC50 = 17.67 ± 5.38 nM) (Figure 3G and H). Furthermore, neither CD63 nor RPN2 silencing inhibited MDR-1 expression in MCF7-ADR cells (Figure 3I). Taken together, these results indicated that deregulation of CD63 attenuated drug resistance as well as invasiveness in breast cancer cells. Therefore, the localization of CD63, which is regulated by RPN2, might contribute to cancer malignancy.

CD63 was co-localized with MDR1 at the cell membrane

We demonstrated that the localization of CD63 was deregulated in MCF7-ADR cells treated with RPN2 siRNA (Figure 2). Previously, we reported that RPN2-knockdown cells showed reduced docetaxel resistance through the reduction of MDR1 membrane localization [9]. As shown in Figure 3C, CD63 siRNA-treated MCF7-ADR cells exhibited increased sensitivity to docetaxel, similar to cells treated with RPN2 siRNA. These results prompted us to hypothesize that the localization of MDR1 is regulated by CD63. To test this hypothesis, immunofluorescence staining was performed using antibodies against CD63 in MCF7-ADR cells. The reduction of the CD63 protein after transduction with siRNA against CD63 was confirmed (Figure 3F). As shown in Figure 4A, the intensity of membrane-bound MDR1 was reduced in MCF7-ADR cells treated with both RPN2 and CD63 siRNAs.

Next, to clarify whether MDR1 localization is regulated by CD63, we conducted a co-immunofluorescence analysis of MCF7-ADR cells treated with control, RPN2 or CD63 siRNAs, using the anti-CD63 and anti-MDR antibodies. Co-immunofluorescence of MDR1 and CD63 indicated that MDR1 was localized at the cell membrane in MCF7-ADR cells transduced with control siRNA, whereas MDR1 was localized in the cytoplasm in RPN2- and CD63-knockdown cells (Figure 4B). Moreover, CD63 co-localized with MDR1 at the cell membrane in MCF7-ADR cells (Figure 4C). Given previous reports showing that CD63 can regulate intracellular and surface trafficking [5], these findings indicated that MDR1 localization was determined by RPN2-mediated glycosylation of CD63. Furthermore, this localization was essential to drug resistance of MCF7-ADR cells.

Lymph node metastasis was associated with CD63 and MDR1 co-expression in clinical samples

An association between cancer malignancy and the co-localization of MDR1 and CD63 in breast cancer clinical samples has not been reported. To determine the relationship between CD63 and MDR1 in clinical samples, we performed immunofluorescent staining of CD63 and MDR1 in a 69 breast cancer tissue microarray. Representative results of positive CD63 and MDR1 co-localization are shown in Figure 5A. Figure 5B shows a negative result for CD63 and MDR1 co-localization. A chi-square test of clinicopathological parameters showed that CD63 (P < 0.05) and MDR1 (P < 0.05) were significantly associated with lymph node (LN) metastasis, which was observed in 5 of 8 (62.5%) of the CD63-positive tumors and 12 of 61 (19.7%) of the CD63-negative tumors. In addition, LN metastasis was observed in 3 of 4 (75%) MDR1-positive tumors and 14 of 65 (21.5%) MDR1-negative tumors. These results indicated a positive correlation between CD63 and MDR1 expression and LN metastasis (Table 1).

Reagents

The antibiotic solution (containing 10,000 U/mL penicillin and 10 mg/mL streptomycin), trypsin-EDTA mixture (containing 0.05% trypsin and EDTA), FBS (fetal bovine serum), donkey anti-mouse-Alexa 488, goat anti-rabbit-Alexa 488, and goat anti-mouse-Alexa 594 were obtained from Invitrogen (Carlsbad, CA, USA). Rabbit polyclonal anti-MDR (H-241, sc-8313) was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Mouse monoclonal anti-actin, clone C4 (MAB1501) was purchased from Millipore (Billerica, MA, USA). The mouse monoclonal anti-CD63 monoclonal (H5C6) antibody was obtained from BD Pharmingen (San Diego, CA, USA). Hoechst 33258 dye was obtained from Dojindo (Kumamoto, Japan). Antigen activation of the tissue microarray was achieved using a protease (#415231, Nichirei, Japan). The duplexes of each siRNA targeting human CD63 mRNA (si CD63-1, GGUGGAAGGAGGAAUGAAAdTdT, UUUCAUUCCUCCUUCCACCdTdT; CD63-2, GGCAGCAGAUGGAGAAUUAdTdT, UAAUUCUCCAUCUGCUGCCdTdT; CD63-3, GUGGCUACGAGGUGAUGUAdTdT, UACAUCACCUCGUAGCCACdTdT) were purchased from BONAC Corporation (Fukuoka, Japan). The siRNA duplexes targeting human RPN2 mRNA (GGCCACUGUUAAACUAGAACA, UUCUAGUUUAACAGUGGCCUG) were purchased from Sigma-Aldrich (St. Louis, MO, USA), and the AllStars Negative Control siRNA was obtained from Qiagen (Valencia, CA, USA).

Cell culture

MDA-MB-231-luc-D3H2LN (MM231-LN) cells were purchased from Xenogen (Alameda, CA), and multidrug-resistant MCF7-ADR cells were provided by Shien-Lab, Medical Oncology, National Cancer Center Hospital of Japan. These cells were maintained in RPMI 1640 medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% heat-inactivated FBS and antibiotic-antimycotic at 37°C in 5% CO².

Transient transfection assays

Transfection of siRNA was accomplished using DharmaFECT transfection reagent (Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s protocol. AllStars Negative Control siRNA was used as the negative control (N.C.).

Cell proliferation assay (MTS assay)

Five thousand cells per well were seeded in 96-well plates. The following day, the cells were transfected with siRNAs. After 1, 2 or 3 days of culture, cell viability was measured using a cell counting Kit-8 (Dojindo, Kumamoto, Japan) according to the instructions of the manufacturer. The absorbance at 450 nm was measured using an Envision multilabel plate reader (Wallac, Turku, Finland).

Apoptotic activity

MM231-LN and MCF7-ADR cells (2 × 10⁵ cells in a 6-well plate) were transfected with control, RPN2 or CD63 siRNA as described above. After 2 days in culture, cells were collected, and proteins were extracted with M-PER (Thermo Scientific). Caspase-3/7 activity was assessed using an Apo-ONE Homogeneous Caspase-3/7 Assay system (Promega, Wisconsin, USA) at an excitation wavelength of 480 nm and an emission wavelength of 520 nm using an Envision system (Wallac).

Transwell invasion assay

Breast cancer cell invasion was assayed in 24-well Biocoat Matrigel™ invasion chambers (8 μm; BD Pharmingen, San Diego, CA, USA) according to the manufacturer’s protocol. Briefly, after the transfection of siRNA into the cells, 20,000 cells were plated in the upper chamber containing RPMI 1640 medium without FBS on the following day. The lower chambers were filled with RPMI 1640 medium with 10% FBS as a chemoattractant. Twenty-two hours later, the low-invasive cells were removed with a cotton swab. The cells that migrated through the membrane and adhered to the lower surface of the membrane were fixed with methanol and stained with Diff Quick staining solution (Sysmex, Kobe, Japan). For quantification, the cells in four random fields were counted using a microscope. All assays were performed in triplicate, and the invasive values were normalized to the values from cells transfected with the AllStars Negative Control siRNA.

Isolation of mRNAs and quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from cultured cells using a miRNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. The qRT-PCR method has previously been described [21]. PCR was performed in 96-well plates using a 7300 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA), and all reactions were performed in triplicate. TaqMan® qRT-PCR kits and human-CD63 and human-β-actin TaqMan® Expression Assays were purchased from Applied Biosystems (Foster City, CA, USA). Reverse transcription (Applied Biosystems, Foster City, CA, USA) and TaqMan® quantitative PCR (Applied Biosystems, Foster City, CA, USA) were performed according to the manufacturer’s instructions. SYBR® Green I qRT-PCR was performed, and the β-actin housekeeping gene was used to normalize the variation in the cDNA levels. The primer sequences are as follows (shown 5′ to 3′): human β-actin, GGCACCACCATGTACCCTG (Forward) and CACGGAGTACTTGCGCTCAG (Reverse); and human RPN2, ATCTAACCTTGATCCCAGCAATUGTG (Forward) and CTGCCAGAAGCAGATCTTTGGTC (Reverse).

Immunoblot analysis

SDS-PAGE gels were calibrated using Precision Plus protein standards (161–0375) (Bio-Rad, Hercules, CA, USA), and anti-CD63 (1:200) and anti-actin (1:1,000) were used as the primary antibodies. The dilution ratio of each antibody is indicated in parentheses. A peroxidase-labeled anti-mouse secondary antibody was used at a dilution of 1:10,000. The bound antibodies were visualized using chemiluminescence with an ECL Plus Western blotting detection system (GE HealthCare, Piscataway, NJ, USA), and luminescent images were captured using a LuminoImager (LAS-3000; FujiFilm Inc., Tokyo, Japan).

Immunofluorescent staining

After being washed three times with PBS, the cells were fixed in 4% paraformaldehyde (Wako, Japan) and incubated in 0.1% BSA containing primary antibodies (anti-CD63 (1:500) and anti-MDR (1:500) for 1 hour. The cells were then incubated in 0.1% BSA containing Alexa Fluor fluorescent secondary antibodies. Nuclei were visualized with Hoechst 33258 dye (Dojindo, Kumamoto, Japan). All staining was observed using a confocal microscope (FluoView FV1000; Olympus, Tokyo, Japan).

Cell membrane labeling

MDA-MB-231-luc-D3H2LN and MCF7-ADR cells were transfected with control or RPN2 siRNA. After 2 days in culture, cells were labeled with a PKH26 red fluorescent labeling kit (Sigma Aldrich). Cells were observed using confocal microscopy (FluoView FV1000; Olympus, Tokyo, Japan). Nuclei were visualized via Hoechst 33258 (Dojindo, Kumamoto, Japan) staining.

Tissue microarrays

The tissue arrays of breast cancer samples (BR1503b, BR10010a) were purchased from Biomax US. The company provided certified documents that all human tissue samples were collected with informed consent from the donors or their relatives. Detailed information on all tumor samples can be found at http://www.biomax.us/. The tissue microarrays were incubated in 0.1% BSA containing primary antibodies, including anti-CD63 (1:500) and anti-MDR (1:500), for 1 hour after a 5-min protease treatment (Nichirei, Tokyo, Japan). The cells were then incubated in 0.1% BSA containing Alexa Fluor fluorescent secondary antibodies. Nuclei were visualized using Hoechst 33258 (Dojindo, Kumamoto, Japan) staining for observation using a confocal microscope (BZ-9000; Keyence, Tokyo, Japan).

Statistical analysis

The data presented in bar graphs are the mean and s.e.m. of at least three independent experiments. Statistical analyses were performed using Student’s t-test. Associations between lymph node metastasis or MDR expression and CD63 expression were assessed by means of a chi-square test. The statistical analysis was two-sided, and P < 0.05 was considered to be significant.