Open Access

HDAC-inhibition counteracts everolimus resistance in renal cell carcinoma in vitro by diminishing cdk2 and cyclin A

  • Eva Juengel1,
  • Snigdha Nowaz1,
  • Jasmina Makarevi1,
  • Iyad Natsheh2,
  • Isabella Werner3,
  • Karen Nelson4,
  • Michael Reiter1,
  • Igor Tsaur1,
  • Jens Mani1,
  • Sebastian Harder5,
  • Georg Bartsch1,
  • Axel Haferkamp1 and
  • Roman A Blaheta1Email author
Molecular Cancer201413:152

https://doi.org/10.1186/1476-4598-13-152

Received: 8 April 2014

Accepted: 3 June 2014

Published: 16 June 2014

Abstract

Background

Targeted therapies have improved therapeutic options of treating renal cell carcinoma (RCC). However, drug response is temporary due to resistance development.

Methods

Functional and molecular changes in RCC Caki-1 cells, after acquired resistance to the mammalian target of rapamycin (mTOR)-inhibitor everolimus (Cakires), were investigated with and without additional application of the histone deacetylase (HDAC)-inhibitor valproic acid (VPA). Cell growth was evaluated by MTT assay, cell cycle progression and apoptosis by flow cytometry. Target molecules of everolimus and VPA, apoptotic and cell cycle regulating proteins were investigated by western blotting. siRNA blockade was performed to evaluate the functional relevance of the proteins.

Results

Everolimus resistance was accompanied by significant increases in the percentage of G2/M-phase cells and in the IC50. Akt and p70S6K, targets of everolimus, were activated in Cakires compared to drug sensitive cells. The most prominent change in Cakires cells was an increase in the cell cycle activating proteins cdk2 and cyclin A. Knock-down of cdk2 and cyclin A caused significant growth inhibition in the Cakires cells. The HDAC-inhibitor, VPA, counteracted everolimus resistance in Cakires, evidenced by a significant decrease in tumor growth and cdk2/cyclin A.

Conclusion

It is concluded that non-response to everolimus is characterized by increased cdk2/cyclin A, driving RCC cells into the G2/M-phase. VPA hinders everolimus non-response by diminishing cdk2/cyclin A. Therefore, treatment with HDAC-inhibitors might be an option for patients with advanced renal cell carcinoma and acquired everolimus resistance.

Keywords

Renal cell carcinoma Everolimus resistance HDAC-inhibition cdk2/cyclin A Tumor growth

Background

Over the past years the therapy for renal cell carcinoma (RCC) has undergone change, with better understanding of the molecular biology of RCC leading to the development of several targeted agents. The phosphatidyl-inositol-3 kinase (PI3K)/Akt/mammalian target of rapamycin (mTOR) pathway has been identified as a pivotal key regulator. mTOR has an impact on various cellular functions, including cell growth, proliferation and cell survival [1]. Two mTOR-inhibitors, temsirolimus (Torisel®) and everolimus (Afinitor®), have been approved by the FDA to treat advanced RCC due to prolonged progression free survival [24]. However, targeted therapy is not curative in metastatic RCC and drug response is limited. Recently, it has been shown that chronic mTOR-inhibition evokes undesired feedback mechanisms in RCC cells, which may lead to resistance development [5, 6]. Undesirable feedback has also been demonstrated in prostate cancer cells after chronic exposure to everolimus, indicating molecular alterations tied to acquired resistance [7]. Agents targeting such feedback loops and cross talk with other pathways involved in acquired resistance to mTOR-inhibition are, therefore, urgently required [8]. Studies and clinical trials have demonstrated that histone deacetylase (HDAC)-inhibitors in combination with other therapies, including targeted therapies, induce synergistic or additive anti-tumor effects [911]. It has also been reported that during chronic application of everolimus, combination with the HDAC-inhibitor valproic acid (VPA) contributes to sustained anti-tumor activity [6]. Additionally, HDAC-inhibitors have been shown to re-sensitize tumor cells to cytotoxic drug treatment [12, 13]. Hence, HDAC-inhibition might prove promising in reversing everolimus resistance in RCC. To follow up on a pilot study employing everolimus resistant RCC Caki-1 cells (Cakires) [6], resistance dependent functional and molecular aberrations were investigated in the same cell line. Further investigation was designed to determine whether Cakires cell growth could be influenced by the HDAC-inhibitor VPA, whereby the growth behavior of Cakires compared to VPA treated Cakires cells was evaluated. It is shown that everolimus resistance contributes to a significant increase in the IC50, an elevated percentage of G2/M-phase cells and distinct up-regulation of the cell cycle activating proteins cdk2 and cyclin A. VPA counteracted everolimus resistance by significantly inhibiting tumor growth and reducing cdk2 and cyclin A. Thus, VPA might represent a new promising treatment option for RCC patients with acquired everolimus resistance.

Results

Exposure to everolimus induced resistance in RCC cells

24 h exposure to ascending concentrations of everolimus [0.1-1 μM] induced a dose dependent significant reduction in the number of Cakipar cells compared to the untreated control (set to 100%, Figure 1A) with an IC50 of 0.78 ± 0.23 nM. Everolimus resistance (Cakires) was evidenced by a significant shift of the IC50 to 10.47 ± 3.14 nM.
Figure 1

Dose response analysis of Caki par and Caki res . (A) Growth efficacy of increasing concentrations of everolimus on Cakipar and Cakires cell growth from 24 h to 72 h. *Indicates significant difference to controls, set to 100% (SD ≤ 16%, n = 6). IC50-values of Cakipar and Cakires cells were calculated from dose response analysis. (B) Cell cycle analysis of unsynchronized and synchronized Cakipar and Cakires cells in subconfluent cell cultures. The cell phase is expressed as percentage of total cells. The figure shows one of five separate experiments.

Resistance towards everolimus significantly enhanced the G2/M-phase

Evaluation of cell cycle progression revealed significant alterations after acquired everolimus resistance. The G2/M-phase percentage was increased in unsynchronized Cakires cells, compared to Cakipar, and was accompanied by a decrease in the S-phase (Figure 1B). Synchronization of the cells led to a similar shift, additionally reducing the percentage of G0/G1-phase cells in Cakires (Figure 1B).

Re-treatment of Cakires with therapeutic everolimus concentrations caused an increase in the G2/M-phase

Treatment of Cakipar for 24 h with 1, 5 or 50 nM everolimus dose-dependently reduced S- and G2/M-phase cells, while the percentage of G0/G1-phase cells increased (Figure 2A). Re-treatment with everolimus had no significant effect on any cell phase in Cakires, regardless of the concentration (Figure 2B). Therefore, all further re-treatment investigation was performed with 1 nM everolimus.
Figure 2

Cell cycle analysis of Caki par (A) and Caki res (B) after 24 h exposure to 1, 5 and 50 nM everolimus in subconfluent cell cultures. The cell population is expressed as percentage of the total cells analyzed. Untreated cells served as controls. One representative experiment of six is shown.

Resistance-dependent alteration in tumor growth was associated with modulated protein expression

After 24 h exposure to 1 nM everolimus, Cakipar revealed a decrease in phosphorylated Akt (pAkt) and p70S6 kinase (pp70S6K) compared to untreated Cakipar (Figure 3). Concomitantly, Akt’s negative regulator PTEN (pPTEN) was activated by 1 nM everolimus. The 24 h application of 1 nM everolimus to Cakipar caused a distinct decrease in the cell cycle activating proteins cdk1 and cdk2 as well as in cyclin A and cyclin B, whereas the negative cell cycle regulator p27 was elevated. Compared to Cakipar, Cakires displayed an activation of pAkt and considerable elevation of cdk1, cdk2, cdk4 and cyclin E, whereas p27, p53 and p73 were diminished. Re-treating Cakires with 1 nM everolimus evoked additional activation of pAkt and pp70S6K, a further augmentation of cdk2 and cyclin A, along with deactivation of pPTEN. However, the expression of p27, p53 and p73 was elevated in Cakires after re-treatment.
Figure 3

Western blot analysis of cell cycle regulating proteins and everolimus target molecules. Cakipar and Cakires treated with 1 nM everolimus for 24 h. Controls remained untreated. β-actin served as the internal control. The figure shows one representative from three separate experiments.

The HDAC-inhibitor VPA inhibited tumor growth in Cakipar and Cakires

Application of the HDAC-inhibitor VPA [1 mM] to Cakipar cells for 1 or 2 weeks contributed to a significant reduction in cell growth (Figure 4A,B), although to a lesser extent than that from 1 nM everolimus exposure. Exposing Cakires to VPA [1 mM] also led to significantly diminished tumor growth (Figure 4A,B). The VPA induced growth inhibition in Cakires was significantly higher than that in Cakipar.
Figure 4

Cell growth analysis. Growth inhibitory efficacy of 1 nM or 1 mM VPA in Cakipar and Cakires cells treated for one (A) or two weeks (B). *Indicates significant difference to untreated controls, set at 100%. #Indicates significant difference between Cakipar + VPA and Cakires + VPA (SD ≤ 22%, n = 6).

Resistance-dependent alterations in protein expression were counteracted by HDAC-inhibition through VPA

VPA caused deactivation of pAkt and pp70S6k in Cakires after 1 or 2 weeks (Figure 5A). In addition, the expression of Akt and p70S6k was diminished with VPA after 1 week. In contrast, the activity of pPTEN was enhanced after 1 or 2 weeks of VPA treatment, compared to untreated Cakires. Applying VPA for 1 or 2 weeks to Cakires caused a considerable decrease in cdk2 and cyclin A and an elevation in p27 (Figure 5A). VPA treatment resulted in increased acetylation (1 or 2 weeks) and increased total content of histone H3 and H4 (2 weeks) in Cakires (Figure 5B).
Figure 5

Western blot analysis of Caki res exposed to 1 mM VPA for one (1 wk) or two weeks (2 wks) showing cell cycle regulating proteins and target molecules of mTOR- (A) and HDAC-inhibitors (B). VPA untreated cells served as controls. β-actin served as the internal control. The figure shows one representative from three separate experiments.

Resistance towards everolimus did not affect apoptosis in RCC

Apoptosis was not influenced by treatment with everolimus in either Cakipar or Cakires (data not shown). In good accordance, examination of the apoptosis proteins caspase 3 and PARP by western blot showed no differences between Cakipar and Cakires and no changes were apparent after treatment with VPA (data not shown).

siRNA knock-down

Since cdk2 and cyclin A were distinctly increased in RCCres and were mainly affected by VPA treatment, their functional relevance during resistance dependent tumor growth was evaluated by siRNA knock-down. Cdk2 and cyclin A siRNA blockade, verified by western blot analysis (Figure 6A), resulted in significant growth inhibition in both Cakipar and Cakires, compared to untreated and siRNA controls (Figure 7A + B left). The impact of HDAC1 and HDAC2 as targets of VPA was also determined by siRNA blockade. HDAC1 and HDAC2 siRNA knock-down contributed to an increase in histone H3 and H4 acetylation in Cakipar and Cakires (Figure 6B). The observed elevation of histone H3 and H4 acetylation was accompanied by significantly reduced tumor growth in Cakipar and Cakires, compared to untreated and siRNA controls (Figure 7A + B right).
Figure 6

siRNA knock-down controls. siRNA blockade of cdk2 or cyclin A (A) and HDAC1 or HDAC2 (B) were confirmed by western blotting. Cakipar and Cakires cells were transfected with cdk2, cyclin A, HDAC1 or HDAC2 siRNA. Untreated cells and with control siRNA transfected cells served as controls. One representative from three experiments is shown.

Figure 7

Influence of cdk2, cyclin A, HDAC1 or HDAC2 knock-down on tumor cell growth. Cakipar(A) and Cakires(B) cells were transfected with cdk2, cyclin A HDAC1 or HDAC2 siRNA and then subjected to the MTT cell growth assay. Untreated cells and with control siRNA transfected cells served as controls. Cell number of control Cakipar or Cakires cells and the corresponding knock-down cells were measured. *Indicates significant difference to untreated and siRNA controls (SD ≤ 18%, n = 6).

Discussion

Chronic everolimus treatment led to drug resistant RCC cells. It was possible to hinder resistance by applying the HDAC-inhibitor VPA.

Cakires revealed a 13-fold higher IC50 than Cakipar. This IC50 change is within the range of the 4 to 22 fold-change used to define drug-resistance [14, 15], indicating clear-cut everolimus resistance. The IC50 shift was associated with a considerable increase in the G2/M-phase, whereby S-phase cells were shifted into the G2/M-phase and the G0/G1-phase fraction was reduced. Such a shift has also been observed during lung cancer drug resistance with an accelerated G2/M-phase transition [16]. In prostate cancer cells everolimus resistance has also revealed a higher G2/M-phase cell cycle fraction [7]. Based on a recent study, chronic everolimus application to RCC cells resulted in an accumulation of G2/M-phase cells [6]. The G2/M-shift may, therefore, be characteristic of chronic everolimus exposure and be associated with resistance development.

Everolimus resistance contributed to characteristic molecular changes, including activation of the everolimus target molecules Akt and p70S6K. Re-treatment of Cakires with 1 nM everolimus evoked additional activation of Akt and p70S6k, whereas the activity of the Akt negative regulator, PTEN, was diminished. Akt is a key molecule with multiple functions, including cell growth and survival. Tumor progression and resistance development in RCC in vitro and in vivo towards different agents has been associated with increased activity of the PI3K/Akt/mTOR signaling pathway [5, 8, 17, 18]. Enhanced activity of Akt has also been shown to be involved in bone metastasis, larger tumor size, grades III/IV tumors and shorter disease-free survival in RCC [1921]. Moreover, elevated Akt phosphorylation has been associated with hyperproliferation and overexpression of cell cycle proteins [22]. Indeed, the present study shows that the cell cycle activating proteins cdk2 and cyclin A were both over-expressed in Cakires compared to Cakipar, and further increased after re-treatment with everolimus. The finding that proteins involved in mitotic control were further up-regulated after applying a therapeutic everolimus concentration is clinically relevant, since mitotic activity of tumor cells is often accelerated, once resistance has developed. In the present investigation the number of mitotic cells significantly increased when Cakires cells were exposed to low-dosed everolimus. This finding might, therefore, explain why RCC patients, treated with temsirolimus or everolimus often develop progressive disease [23]. The same progression has been observed in different gynecologic cancers as well as estrogen receptor-positive breast cancer and colorectal carcinoma, indicating a correlation between treatment resistance and enhanced aggressiveness characterized by accelerated tumor growth [2426].

The functional relevance of cdk2 and cyclin A in tumor growth was verified by siRNA knock down, revealing significant growth inhibition after cdk2 and cyclin A loss. Cdk2 and cyclin A establish complexes in the S-phase and are required for entrance into the G2/M-phase. Indeed, low expression of cdk2 and cyclin A has been shown to be associated with cell cycle arrest and accumulation of cells in the S-phase [27]. Everolimus resistance has also been associated with a considerable increase in cdk2 in prostate cancer [7] and in RCC cells [6]. Thus, augmented cdk2 seems closely related to non-responsiveness towards everolimus and deserves attention in overcoming resistance development. High levels of cyclin A have been associated with a worse outcome and have been proposed as a prognostic factor in breast cancer, as well [2830]. Similarly, a cyclin A increase in RCC has been associated with elevated tumor size and poor survival [31]. In good accordance with the present findings regarding Cakires, cyclin A expression has been shown to be inversely correlated with the expression of the cell cycle negative regulator p27 in RCC [31]. It may, therefore, be concluded that resistance development towards everolimus is accompanied by elevated cdk2/cyclin A, driving tumor cells from the S- into the G2/M-phase, leading to a more aggressive tumor phenotype with enhanced growth capacity.

The HDAC-inhibitor VPA caused a significant decrease in RCC tumor growth. Since VPA’s growth inhibitory effect on Caki-1 was even more pronounced in Cakires than in Cakipar, VPA seems to re-sensitize the tumor cells to everolimus. However, it may also be concluded that chronic treatment with everolimus sensitizes the cells to VPA treatment. Although this is speculative, various studies have shown that HDAC-inhibitors in combination with everolimus induce synergistic anti-tumor effects [10]. HDAC-inhibitors have been implicated in the re-sensitization of tumor cells to cytotoxic drug treatment [12, 13] and concomitant application of VPA with chemo- or targeted therapies has shown that VPA prevents tumor cells from becoming resistant [6, 32]. VPA may, therefore, counteract resistance dependent feedback loops and reverse molecular alterations in everolimus resistant cells. VPA treatment did deactivate proteins associated with mitosis in the Cakires cells, particularly Akt and p70S6k. Both cdk2 and cyclin A were strongly enhanced in Cakires and were considerably reduced in the presence of VPA. Thus, cdk2 and cyclin A could serve as predictive indicators for a response to VPA. In several tumor entities application of VPA for up to 2 weeks has resulted in counter-regulation of the cdk-cyclin axis, contributing to significant growth inhibition [6, 33]. Since cdk2/cyclin A reduction and growth inhibition in Cakires after application with VPA was accompanied by acetylation of histone H3 and H4, epigenetic modification might be involved in the anti-tumor effect. Other investigators have also reported an association between histone H3 and H4 acetylation, cdk2 reduction and diminished growth in bladder and prostate cancer cells [33, 34]. Knock-down of HDAC1 and HDAC2, responsible for deacetylation of histone H3 and H4 [35, 36], has induced considerable acetylation of histone H3 and H4 in Cakires, correlating with significant growth inhibition. The present investigation also indicates that histone H3 and H4 acetylation diminishes tumor growth, probably by influencing the cell cycle activating proteins cdk2/cyclin A.

Conclusion

The present findings reveal that resistance development towards the mTOR-inhibitor, everolimus, is associated with undesired feedback loops, including activation of the Akt/mTOR signaling pathway and increased cdk2/cyclin A expression, and is associated with cell cycle progression and tumor growth. Evidence is provided that re-treatment with everolimus not only fails to inhibit tumor progression in Cakires, but activates progression. Since resistance is a serious problem in treating RCC the HDAC-inhibitor VPA could be employed to impair cdk2/cyclin A expression. Acetylation of histone H3 and H4 plays a pivotal role in this process, significantly inhibiting tumor cell growth. Patients with renal cell carcinoma and acquired everolimus resistance might, therefore, benefit from treatment with VPA. In vivo investigation and clinical trials are necessary to verify tumor growth inhibition by VPA in everolimus resistant renal cell carcinoma.

Methods

Cell culture

Kidney carcinoma cells, Caki-1, were purchased from LGC Promochem (Wesel, Germany). The cells were grown and subcultured in RPMI 1640 medium (Seromed, Berlin, Germany) supplemented with 10% FCS, 20 mM Hepes-buffer, 100 IU/ml penicillin and 100 μg/ml streptomycin at 37°C in a humidified, 5% CO2 incubator.

Drugs

Everolimus (RAD001, Afinitor™, Novartis Pharma AG, Basel, Switzerland) was dissolved in DMSO as a 10 mM stock solution and stored as aliquots at -20°C. Prior to experiments, everolimus was diluted in cell culture medium. Resistance towards everolimus was induced by treating Caki-1 cells with stepwise ascending concentrations from 1 nM up to 1 μM. The tumor cells were further exposed to 1 μM everolimus twice a week for over one year. Tumor cells, resistant to everolimus, were designated Cakires and control cells, sensitive to everolimus, were designated Cakipar.

Besides comparing characteristics of Cakires to Cakipar, the response to therapeutic everolimus concentrations (drug re-treatment) was also investigated. Preparation for everolimus re-treatment was carried out by incubating Cakires cells for three days with everolimus-free medium. Subsequently, 1, 5 or 50 nM everolimus was applied to the Cakires and Cakipar cells.

Valproic acid (VPA) (G. L. Pharma GmbH, Lannach, Austria) was applied at a final concentration of 1 mM to Cakires and Cakipar cells twice a week over a total of either 1 or 2 weeks. Control cell cultures remained untreated.

To evaluate toxic effects of applied drugs, cell viability was determined by trypan blue (Gibco/Invitrogen, Darmstadt, Germany).

Apoptosis

To detect apoptosis the expression of Annexin V/propidium iodide (PI) was evaluated using the Annexin V-FITC Apoptosis Detection kit (BD Pharmingen, Heidelberg, Germany). Tumor cells were washed twice with PBS-buffer, and then incubated with 5 μl of Annexin V-FITC and 5 μl of PI in the dark for 15 min at room temperature. Cells were analyzed on a FACScalibur (BD Biosciences, Heidelberg, Germany). The percentage of vital, necrotic and apoptotic cells (early and late) in each quadrant was calculated using Cell-Quest software (BD Biosciences).

Measurement of tumor cell growth and proliferation

Cell growth was assessed using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye reduction assay (Roche Diagnostics, Penzberg, Germany). RCC cells (50 μl, 1×105 cells/ml) were seeded onto 96-well tissue culture plates. After 24, 48 and 72 h MTT (0.5 mg/ml) was added for an additional 4 h. Thereafter, cells were lysed in a buffer containing 10% SDS in 0.01 M HCl. The plates were incubated overnight at 37 °C, 5% CO2. Absorbance at 550 nm was determined for each well using a microplate ELISA reader. Each experiment was done in triplicate. After subtracting background absorbance, results were expressed as mean cell number. IC50 values were calculated on the basis of the dose response analysis of Cakipar and Cakires using GraphPad Prism 5.0.

Cell cycle analysis

Cell cycle analysis was performed with RCC cultures grown to subconfluency and carried out after 24 h using both asynchronous and synchronous cell populations. Caki-1 cells were synchronized at the G1-S boundary with aphidicolin (1 μg/ml) 24 h before starting cell cycle analysis and subsequently resuspended in fresh (aphidicolin free) medium for 2 h. Asynchronous or synchronous tumor cell populations were stained with propidium iodide using a Cycle TEST PLUS DNA Reagent Kit (Becton Dickinson) and then subjected to flow cytometry with a FACScan flow cytometer (Becton Dickinson). 10,000 events were collected from each sample. Data acquisition was carried out using Cell-Quest software and cell cycle distribution, calculated with ModFit software (Becton Dickinson). The number of gated cells in the G1-, S- or G2/M-phases were expressed in%.

Western blot analysis

To investigate cell cycle regulating proteins in Caki-1 cells, tumor cell lysates (50 μg) were applied to polyacrylamide gels (7-15%) and electrophoresed for 90 min at 100 V. The protein was then transferred to nitrocellulose membranes. After blocking with non-fat dry milk for 1 h, the membranes were incubated overnight with monoclonal antibodies directed against cell cycle proteins: cdk1 (mouse IgG1, clone 1, dilution 1:2,500), cdk2 (mouse IgG2a, clone 55, dilution 1:2,500), cdk4 (mouse IgG1, clone 97; dilution 1:250), cyclin A (mouse IgG1, clone 25, dilution 1:250), cyclin B (mouse IgG1, clone 18, dilution 1:1,000), cyclin D1 (mouse IgG1, clone G124-326, dilution 1:250), cyclin E (mouse IgG1, clone HE12, dilution 1:1,000), p19 (mouse IgG1, clone 52/p19, 1:5,000), p21 (mouse IgG1, clone 2G12, dilution 1:250), p27 (Kip1, mouse IgG1, clone 57, 1:500), p53 (mouse IgG2b, clone DO-7, dilution 1:500) and p73 (mouse IgG1, clone ER-15, dilution 1:500, all: BD Biosciences). Apoptotic effects, the protein expression of caspase 3 and PARP (both: rabbit IgG, dilution 1:1,000, Cell Signaling Technology by New England Biolabs GmbH, Frankfurt, Germany) were also investigated. To evaluate target specificity of everolimus and VPA, mTOR signaling and histone acetylation were evaluated. The following monoclonal antibodies were employed to determine mTOR signaling: Akt (PKBα/Akt, clone 55), phospho Akt (pAkt; clone 104A282, both: mouse IgG1, dilution 1:500, BD Biosciences), p70S6k (clone 49D7), phospho p70S6k (pp70S6k; clone 108D2), PTEN (phosphatase and tensin homolog) and phospho PTEN (Ser380/Thr382/383, all: rabbit IgG, dilution 1:1,000, Cell Signaling Technology). To investigate histone acetylation, cell lysates were marked with anti-histone H3 (rabbit IgG, clone Y173, dilution 1:5,000), anti-acetylated H3 (rabbit IgG, clone Y28, dilution 1:500, both: Epitomics, USA), anti-histone H4 (rabbit IgG, clone: N/A, dilution 1:250, Imgenex, USA) and anti-acetylated H4 (Lys8, rabbit IgG, dilution 1:500, Upstate Biotechnology, USA). HRP-conjugated goat-anti-mouse or goat-anti-rabbit IgG (both: dilution 1:5,000, Upstate Biotechnology, Lake Placid, NY, USA) were used as secondary antibodies. The membranes were briefly incubated with ECL detection reagent (ECL™, Amersham/GE Healthcare, München, Germany) to visualize the proteins and exposed to an x-ray-film (Hyperfilm™ EC™; Amersham/GE Healthcare). β-actin (dilution 1:1,000, Sigma, Taufenkirchen, Germany) served as the internal control.

siRNA blockade

Caki-1 cells (3×105/6-well) were transfected with small interfering RNA (siRNA) directed against cdk2 (gene ID: 1017, target sequence: AGGTGGTGGCGCTTAAGAAAA), cyclin A (gene ID: 890, target sequence: GCCAGCTGTCAGGATAATAAA), HDAC1 (gene ID: 3065, target sequence: CACCCGGAGGAAAGTCTGTTA) or HDAC2 (gene ID: 3066, target sequence: TCCCAATGAGTTGCCATATAA; all: Qiagen, Hilden, Germany) with a siRNA/transfection reagent (HiPerFect Transfection Reagent; Qiagen, Hilden, Germany) ratio of 1:6. Untreated cells and cells treated with 5 nM control siRNA (All stars negative control siRNA; Qiagen, Hilden, Germany) served as controls. Knock-down was verified by western blot analysis. Tumor cell growth was analyzed by the MTT assay as indicated above.

Statistics

All experiments were performed 3-6 times. Statistical significance was investigated by the Wilcoxon-Mann-Whitney-U-test. Differences were considered statistically significant at a p-value less than 0.05.

Authors’ information

Axel Haferkamp and Roman A Blaheta contributed equally as senior authors.

Declarations

Acknowledgements

This work was supported by the ”Prof. Dr. Karl und Gerhard Schiller-Stiftung”, ”Friedrich-Spicker-Stiftung” and “Gisela-Stadelmann-Stiftung”.

Authors’ Affiliations

(1)
Department of Urology, Goethe-University
(2)
Royal Scientific Society
(3)
Department of Thoracic and Cardiovascular Surgery, Goethe-University
(4)
Department of Vascular and Endovascular Surgery, Goethe-University
(5)
Department of Clinical Pharmacology, Goethe-University

References

  1. Laplante M, Sabatini DM: mTOR signaling in growth control and disease. Cell. 2012, 149 (2): 274-293. 10.1016/j.cell.2012.03.017PubMed CentralView ArticlePubMedGoogle Scholar
  2. Motzer RJ, Escudier B, Oudard S, Hutson TE, Porta C, Bracarda S, Grünwald V, Thompson JA, Figlin RA, Hollaender N, Urbanowitz G, Berg WJ, Kay A, Lebwohl D, Ravaud A: RECORD-1 Study Group: Efficacy of everolimus in advanced renal cell carcinoma: a double-blind, randomised, placebo-controlled phase III trial. Lancet. 2008, 372 (9637): 449-456. 10.1016/S0140-6736(08)61039-9View ArticlePubMedGoogle Scholar
  3. Motzer RJ, Escudier B, Oudard S, Hutson TE, Porta C, Bracarda S, Grünwald V, Thompson JA, Figlin RA, Hollaender N, Kay A, Ravaud A: RECORD‒1 Study Group: Phase 3 trial of everolimus for metastatic renal cell carcinoma: final results and analysis of prognostic factors. Cancer. 2010, 116 (18): 4256-4265. 10.1002/cncr.25219View ArticlePubMedGoogle Scholar
  4. Hudes G, Carducci M, Tomczak P, Dutcher J, Figlin R, Kapoor A, Staroslawska E, Sosman J, McDermott D, Bodrogi I, Kovacevic Z, Lesovoy V, Schmidt-Wolf IG, Barbarash O, Gokmen E, O'Toole T, Lustgarten S, Moore L, Motzer RJ: Global ARCC Trial: Temsirolimus, interferon alfa, or both for advanced renal-cell carcinoma. N Engl J Med. 2007, 356 (22): 2271-2281. 10.1056/NEJMoa066838View ArticlePubMedGoogle Scholar
  5. Harada K, Miyake H, Kumano M, Fujisawa M: Acquired resistance to temsirolimus in human renal cell carcinoma cells is mediated by the constitutive activation of signal transduction pathways through mTORC2. Br J Cancer. 2013, 109 (9): 2389-2395. 10.1038/bjc.2013.602PubMed CentralView ArticlePubMedGoogle Scholar
  6. Juengel E, Dauselt A, Makarević J, Wiesner C, Tsaur I, Bartsch G, Haferkamp A, Blaheta RA: Acetylation of histone H3 prevents resistance development caused by chronic mTOR inhibition in renal cell carcinoma cells. Cancer Lett. 2012, 324 (1): 83-90. 10.1016/j.canlet.2012.05.003View ArticlePubMedGoogle Scholar
  7. Tsaur I, Makarević J, Hudak L, Juengel E, Kurosch M, Wiesner C, Bartsch G, Harder S, Haferkamp A, Blaheta RA: The cdk1-cyclin B complex is involved in everolimus triggered resistance in the PC3 prostate cancer cell line. Cancer Lett. 2011, 313 (1): 84-90. 10.1016/j.canlet.2011.08.026View ArticlePubMedGoogle Scholar
  8. Santoni M, Pantano F, Amantini C, Nabissi M, Conti A, Burattini L, Zoccoli A, Berardi R, Santoni G, Tonini G, Santini D, Cascinu S: Emerging strategies to overcome the resistance to current mTOR inhibitors in renal cell carcinoma. Biochim Biophys Acta. 2014, 1845 (2): 221-231.PubMedGoogle Scholar
  9. Chen CH, Chen MC, Wang JC, Tsai AC, Chen CS, Liou JP, Pan SL, Teng CM: Synergistic Interaction between the HDAC Inhibitor, MPT0E028, and Sorafenib in Liver Cancer Cells In Vitro and In Vivo. Clin Cancer Res. 2014, 20 (5): 1274-1287. 10.1158/1078-0432.CCR-12-3909PubMed CentralView ArticlePubMedGoogle Scholar
  10. Hrabeta J, Stiborova M, Adam V, Kizek R, Eckschlager T: Histone deacetylase inhibitors in cancer therapy. A review. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. in press,Google Scholar
  11. Ellis L, Ku SY, Ramakrishnan S, Lasorsa E, Azabdaftari G, Godoy A, Pili R: Combinatorial antitumor effect of HDAC and the PI3K-Akt-mTOR pathway inhibition in a Pten defecient model of prostate cancer. Oncotarget. 2013, 4 (12): 2225-2236.PubMed CentralView ArticlePubMedGoogle Scholar
  12. de Jong E, Winkel P, Poelstra K, Prakash J: Anticancer effects of 15d-prostaglandin-J2 in wild-type and doxorubicin-resistant ovarian cancer cells: novel actions on SIRT1 and HDAC. PLoS One. 2011, 6: e25192- 10.1371/journal.pone.0025192PubMed CentralView ArticlePubMedGoogle Scholar
  13. Stronach EA, Alfraidi A, Rama N, Datler C, Studd JB, Agarwal R, Guney TG, Gourley C, Hennessy BT, Mills GB, Mai A, Brown R, Dina R, Gabra H: HDAC4-regulated STAT1 activation mediates platinum resistance in ovarian cancer. Cancer Res. 2011, 71: 4412-4422. 10.1158/0008-5472.CAN-10-4111PubMed CentralView ArticlePubMedGoogle Scholar
  14. Fong JT, Jacobs RJ, Moravec DN, Uppada SB, Botting GM, Nlend M, Puri N: Alternative Signaling Pathways as Potential Therapeutic Targets for Overcoming EGFR and c-Met Inhibitor Resistance in Non-Small Cell Lung Cancer. PLoS One. 2013, 8 (11): e78398- 10.1371/journal.pone.0078398PubMed CentralView ArticlePubMedGoogle Scholar
  15. Sakai I, Miyake H, Fujisawa M: Acquired resistance to sunitinib in human renal cell carcinoma cells is mediated by constitutive activation of signal transduction pathways associated with tumour cell proliferation. BJU Int. 2013, 112 (2): E211-E220. 10.1111/j.1464-410X.2012.11655.xView ArticlePubMedGoogle Scholar
  16. Liu J, Xiao Z, Wong SK, Tin VP, Ho KY, Wang J, Sham MH, Wong MP: Lung cancer tumorigenicity and drug resistance are maintained through ALDH(hi)CD44(hi) tumor initiating cells. Oncotarget. 2013, 4 (10): 1698-1711.PubMed CentralView ArticlePubMedGoogle Scholar
  17. Lin A, Piao HL, Zhuang L, Sarbassov DD, Ma L, Gan B: FoxO transcription factors promote AKT Ser473 phosphorylation and renal tumor growth in response to pharmacological inhibition of the PI3K-AKT pathway. Cancer Res. 2014, 74 (6): 1682-1693. 10.1158/0008-5472.CAN-13-1729PubMed CentralView ArticlePubMedGoogle Scholar
  18. Juengel E, Makarević J, Tsaur I, Bartsch G, Nelson K, Haferkamp A, Blaheta RA: Resistance after chronic application of the HDAC-inhibitor valproic acid is associated with elevated Akt activation in renal cell carcinoma in vivo. PLoS One. 2013, 8 (1): e53100- 10.1371/journal.pone.0053100PubMed CentralView ArticlePubMedGoogle Scholar
  19. Joeckel E, Haber T, Prawitt D, Junker K, Hampel C, Thüroff JW, Roos FC, Brenner W: High calcium concentration in bones promotes bone metastasis in renal cell carcinomas expressing calcium-sensing receptor. Mol Cancer. 2014, 13 (1): 42- 10.1186/1476-4598-13-42PubMed CentralView ArticlePubMedGoogle Scholar
  20. Ou YC, Li JR, Kuan YH, Raung SL, Wang CC, Hung YY, Pan PH, Lu HC, Chen CJ: Luteolin sensitizes human 786-O renal cell carcinoma cells to TRAIL-induced apoptosis. Life Sci. 2014, 100 (2): 110-117. 10.1016/j.lfs.2014.02.002View ArticlePubMedGoogle Scholar
  21. White NM, Masui O, Newsted D, Scorilas A, Romaschin AD, Bjarnason GA, Siu KW, Yousef GM: Galectin-1 has potential prognostic significance and is implicated in clear cell renal cell carcinoma progression through the HIF/mTOR signaling axis. Br J Cancer. 2014, 110 (5): 1250-1259. 10.1038/bjc.2013.828PubMed CentralView ArticlePubMedGoogle Scholar
  22. El Andalousi J, Li Y, Anand-Srivastava MB: Natriuretic peptide receptor-C agonist attenuates the expression of cell cycle proteins and proliferation of vascular smooth muscle cells from spontaneously hypertensive rats: role of Gi proteins and MAPkinase/PI3kinase signaling. PLoS One. 2013, 8 (10): e76183- 10.1371/journal.pone.0076183PubMed CentralView ArticlePubMedGoogle Scholar
  23. Voss MH, Bastos DA, Karlo CA, Ajeti A, Hakimi AA, Feldman DR, Hsieh JJ, Molina AM, Patil S, Motzer RJ: Treatment outcome with mTOR inhibitors for metastatic renal cell carcinoma with nonclear and sarcomatoid histologies. Ann Oncol. 2014, 25 (3): 663-668. 10.1093/annonc/mdt578PubMed CentralView ArticlePubMedGoogle Scholar
  24. Arnedos M, Drury S, Afentakis M, A'hern R, Hills M, Salter J, Smith IE, Reis-Filho JS, Dowsett M: Biomarker changes associated with the development of resistance to aromatase inhibitors (AIs) in estrogen receptor-positive breast cancer. Ann Oncol. 2014, 25 (3): 605-610. 10.1093/annonc/mdt575PubMed CentralView ArticlePubMedGoogle Scholar
  25. Deb S, Xu H, Tuynman J, George J, Yan Y, Li J, Ward RL, Mortensen N, Hawkins NJ, McKay MJ, Ramsay RG, Fox SB: RAD21 cohesin overexpression is a prognostic and predictive marker exacerbating poor prognosis in KRAS mutant colorectal carcinomas. Br J Cancer. 2014, 110 (6): 1606-1613. 10.1038/bjc.2014.31PubMed CentralView ArticlePubMedGoogle Scholar
  26. Jeong HM, Kwon MJ, Shin YK: Overexpression of Cancer-Associated Genes via Epigenetic Derepression Mechanisms in Gynecologic Cancer. Front Oncol. 2014, 4: 12-PubMed CentralView ArticlePubMedGoogle Scholar
  27. Li J, Zhu W, Leng T, Shu M, Huang Y, Xu D, Qiu P, Su X, Yan G: Triptolide-induced cell cycle arrest and apoptosis in human renal cell carcinoma cells. Oncol Rep. 2011, 25 (4): 979-987.View ArticlePubMedGoogle Scholar
  28. Klintman M, Strand C, Ahlin C, Beglerbegovic S, Fjällskog ML, Grabau D, Gudlaugsson E, Janssen EA, Lövgren K, Skaland I, Bendahl PO, Malmström P, Baak JP, Fernö M: The Prognostic Value of Mitotic Activity Index (MAI), Phosphohistone H3 (PPH3), Cyclin B1, Cyclin A, and Ki67, Alone and in Combinations, in Node-Negative Premenopausal Breast Cancer. PLoS One. 2013, 8 (12): e81902- 10.1371/journal.pone.0081902PubMed CentralView ArticlePubMedGoogle Scholar
  29. Strand C, Ahlin C, Bendahl PO, Fjällskog ML, Hedenfalk I, Malmström P, Fernö M: Combination of the proliferation marker cyclin A, histological grade, and estrogen receptor status in a new variable with high prognostic impact in breast cancer. Breast Cancer Res Treat. 2012, 131 (1): 33-40. 10.1007/s10549-011-1386-5View ArticlePubMedGoogle Scholar
  30. Ahlin C, Zhou W, Holmqvist M, Holmberg L, Nilsson C, Jirström K, Blomqvist C, Amini RM, Fjällskog ML: Cyclin A is a proliferative marker with good prognostic value in node-negative breast cancer. Cancer Epidemiol Biomarkers Prev. 2009, 18 (9): 2501-2506. 10.1158/1055-9965.EPI-09-0169View ArticlePubMedGoogle Scholar
  31. Migita T, Oda Y, Naito S, Tsuneyoshi M: Low expression of p27(Kip1) is associated with tumor size and poor prognosis in patients with renal cell carcinoma. Cancer. 2002, 94 (4): 973-979. 10.1002/cncr.10338View ArticlePubMedGoogle Scholar
  32. Blaheta RA, Michaelis M, Natsheh I, Hasenberg C, Weich E, Relja B, Jonas D, Doerr HW, Cinatl J: Valproic acid inhibits adhesion of vincristine- and cisplatin-resistant neuroblastoma tumour cells to endothelium. Br J Cancer. 2007, 96: 1699-1706. 10.1038/sj.bjc.6603777PubMed CentralView ArticlePubMedGoogle Scholar
  33. Vallo S, Xi W, Hudak L, Juengel E, Tsaur I, Wiesner C, Haferkamp A, Blaheta RA: HDAC inhibition delays cell cycle progression of human bladder cancer cells in vitro. Anticancer Drugs. 2011, 22: 1002-1009.PubMedGoogle Scholar
  34. Wedel S, Hudak L, Seibel JM, Makarević J, Juengel E, Tsaur I, Waaga-Gasser A, Haferkamp A, Blaheta RA: Molecular targeting of prostate cancer cells by a triple drug combination down-regulates integrin driven adhesion processes, delays cell cycle progression and interferes with the cdk-cyclin axis. BMC Cancer. 2011, 11: 375- 10.1186/1471-2407-11-375PubMed CentralView ArticlePubMedGoogle Scholar
  35. Kumar P, Tripathi S, Pandey KN: Histone Deacetylase Inhibitors Modulate the Transcriptional Regulation of Guanylyl Cyclase/Natriuretic Peptide Receptor-A Gene: Interactive roles of Modified Histones, HATS, p300, and Sp1. J Biol Chem. in press,Google Scholar
  36. Jones J, Juengel E, Mickuckyte A, Hudak L, Wedel S, Jonas D, Blaheta RA: The histone deacetylase inhibitor valproic acid alters growth properties of renal cell carcinoma in vitro and in vivo. J Cell Mol Med. 2009, 13: 2376-2385. 10.1111/j.1582-4934.2008.00436.xView ArticlePubMedGoogle Scholar

Copyright

© Juengel et al.; licensee BioMed Central Ltd. 2014

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement