Patients and specimens
Fresh tumor tissue samples with paired non-cancerous liver tissue samples of 24 HCC patients were obtained in operation from the Nanfang hospital and Cancer Center of Southern medical university (SMUCC). A total of 168 paraffin-embedded HCC samples, which were histologically and clinically diagnosed in patients with radical surgery in NanFang hospital, between 2000 and 2007, were also included in this study. Resected specimens, fixed in 10 % formalin solution and then embedded in paraffin, were longitudinally sliced into 4-mm-thick sections. Representative sections were prepared and stained with hematoxylin and eosin for histologic examination. Western-blot was used to confirm the specificity of CTSB staining in fresh HCC tissues with paired non-cancerous liver tissues and cell lines MHCC-97H and MHCC-97 L. None of these patients had received radiotherapy or chemotherapy prior to surgical treatment. Clinical and pathological data of the 168 patients with HCC were collected, such as age, tumor size, stage, differentiation grade, and recurrence. The tumor stages were classified according to the 2010 TNM staging system of Union for International Cancer Control (UICC). Tumor differentiation was classified using the Edmondson grading system. Clinical follow-up information was obtained by telephone or from the outpatient records.
Written Ethics Approval and Patient Consent from the Research Ethics Committee of Nanfang Hospital and SMUCC were obtained. Participants were recruited and human experimentation was conducted in Nanfang Hospital and SMUCC. We have obtained written informed consent from all participants involved in the study.
Cell culture
The HCC cell lines MHCC-97H, MHCC-97 L, Huh-7, HepG2, SMMC-7721, Bel-7404, and human hepatocyte cell line HL-7702 were obtained from The Cell Bank of Type Culture Collection of Chinese Academy of Sciences. MHCC-97H and MHCC-97 L were derived from the same parent cell MHCC-97 to ensure a similar genetic background and yet dramatic differences in spontaneous metastatic behavior. Compared with MHCC-97 L, which was not metastatic via subcutaneous inoculation, MHCC-97H featured more overt multidirectional metastasis. Cells were maintained in RPMI 1640 medium (Gibco, Invitrogen, Carlsbad, CA, USA) supplemented with 10 % fetal bovine serum (FBS; Hyclone, Logan, UT, USA), penicillin (100 units/ml), and streptomycin (100 units/ml) at 37 °C in humidified 5 % CO2 incubator.
Western blot analysis
Equal amounts of protein lysates were separated by SDS-PAGE and transferred onto nitrocellulose membranes. Filters were probed with the following specific primary antibodies: anti-CTSB (Cell signaling, Danvers, MA, USA), MMP-9 (Abcam, Cambridge, MA, USA), β-actin (Sigma, St Louis, MO, USA), PI3K and phosphorylated-PI3K (Cell signaling, Danvers, MA, USA), Akt and phosphorylated-Akt (Cell signaling, Danvers, MA, USA), mTOR, and phosphorylated-mTOR (Cell signaling, Danvers, MA, USA). Blots were then incubated with horseradish peroxidase-conjugated secondary antibody (Pierce, Rockford, IL, USA) and visualized by chemiluminescence. The band density was quantified by densitometry using Scion Image software, and normalized to β-actin levels.
Real-time RT-PCR analysis
Total RNA from human tissues was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. cDNA was synthesized from 1 μg of total RNA by use of the SuperScript® III First-Strand Synthesis System (Invitrogen, Carlsbad, CA). Real-time PCR was carried out using CFX96 Real-Time System (BIO-RAD). SYBR green 2× master mixture (Invitrogen, Carlsbad, CA, USA) was used in a total volume of 10 μL. The primer sequences were as follows: CTSB sense 5′- GGCCTCTATGACTCGCATGT -3′, antisense 5′- TTTGTAGGACGGGGTGTAGC -3′, GAPDH sense 5′-TGTTGCCATCAATGACCCCTT-3′, antisense 5′-CTCCACGACGTACTCAGCG-3′. GAPDH was used as an internal control. All reactions were run in triplicate in three independent experiments.
Immunohistochemical analysis
Immunohistochemical (IHC) staining was performed using Dako Envision system (Dako, Carpinteria, CA) according to the manufacturer’s instructions. Briefly, 4 μm formalin-fixed paraffin-embedded sections were made and subsequently deparaffinized with xylenes, and rehydrated through graded ethanol series to distilled water. Antigen retrieval was done by heating sections with EDTA antigenic retrieval buffer (pH 8.0) in a microwave oven. Following endogenous peroxidase blocking in 0.3 % H2O2 for 15 minutes and nonspecific binding blocking with normal goat serum for 30 minutes, the sections were incubated with rabbit polyclonal anti-CTSB antibody (1:50; Santa Cruz Biotechnology) overnight at 4 °C. After sequential incubation with biotinylated anti-goat secondary antibody (Zymed) and streptavidin-horse-radish peroxidase (Zymed), reaction product was developed with Diaminobenzidine (DAB). Negative control was composed of mixture with no primary antibody but normal goat serum instead.
Three pathologists scored the immunohistochemically stained slides independently. Sum of intensity and extent score scaling from 0 to 7 was used as to assess and grade expression of CTSB into two groups: low (<3) and high (>3) expression.
Vector construction and transfection
The pcDNA3.0 vector was used to generate pcDNA-CTSB. The CTSB shRNA Plasmid was purchased from Santa Cruz Biotechnology (Cat. no: sc-29238-SH). Vector transfection was performed according to the instructions. MHCC-97 L cell line was transfected with pcDNA expressing CTSB or empty vector, and MHCC-97H was used to knock-down the expression of CTSB. MHCC-97 L cells expressing CTSB or empty vector were selected for 14 days with G418 after infection. MHCC-97H cells transfected with CTSB-shRNA or Con-shRNA were selected for 14 days with puromycin after infection. In addition, MHCC-97H/CTSB-shRNA was transfected with pcDNA expressing MMP-9, and then used for the further experiments.
Wound Healing Assay
Cell migration ability was assessed by measuring the movement of cells into scraped cellular area created by a 10 μl pipette tube when cells were grown to 80-90 % confluence in six-well culture plates. The phase contrast images of the wounds were recorded of 0, 24, 48 h and three separate experiments were performed. Cells transfected with empty vector and parental cells served as controls.
Cell Invasion Assay
Upper chambers of 24-well transwell plate (Corning Incorporated, New York, NY, USA) were coated with 50 % Matrigel (BD Biosciences, Franklin, New Jersey, USA) in phosphate-buffered saline. Cells were incubated in the upper chamber. After 24 h incubation, invaded cells were stained with 0.5 % crystal violet, examined by bright field microscopy (OLYMPUS cx31, TOKYO, Japan), and photographed. Invasion rate was quantified by counting the invaded cells in five random fields per chamber under the fluorescence microscope (OLYMPUS IX71, TOKYO, Japan). Data summarized three independent experiments.
Tumor formation in an animal model
Equivalent amounts of MHCC97L/CTSB cells and MHCC97H/CTSB-shRNA cells (5 × 105 cells) were injected subcutaneously into the right flank of female BALB/c nude mice (Shanghai Slac Laboratory Animal Co. Ltd, Shanghai, China) at 5 weeks of age (15–17.5 g) respectively. Tumorigenesis procedure was observed by measuring solid tumors in 3 dimensions with a caliper for 21 days. Animals were sacrificed 21 days after injection. The experiments on mice had been approved by the ethics committee at SMUCC.
Statistical analysis
Statistical analyses were performed using a statistical software package (SPSS19.0, Chicago, IL). The significance of CTSB mRNA levels was determined by t-test. The chi-square test was used to analyze the relationship between CTSB expression and clinicopathological characteristics. Survival times were evaluated using the Kaplan and Meier survival curves, and compared by the log-rank test. The significance of various variables for survival was analyzed by multivariate survival analysis using Cox’s regression model. P-value less than or equal to 5 percent was considered to be statistically significant.
